View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5031-Insertion-8 (Length: 259)

Name: NF5031-Insertion-8
Description: NF5031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5031-Insertion-8
NF5031-Insertion-8
[»] chr7 (1 HSPs)
chr7 (109-259)||(46556986-46557136)


Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 109 - 259
Target Start/End: Original strand, 46556986 - 46557136
Alignment:
109 gattggttctgtatcaggccataactcagctcgtttaccggtttgtgttagtatcttaatcagtgtatcggtgtcgacagtcccctttacttctactttt 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46556986 gattggttctgtatcaggccataactcagctcgtttaccggtttgtgttagtatcttaatcagtgtatcggtgtcgacagtcccctttacttctactttt 46557085  T
209 tgttgcttcaaatcaatagttgtttgataaacacccgatttaacaacaata 259  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||    
46557086 tgttgcttcaaatcaatagttgtttgataaacacctgatttaacaacaata 46557136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University