View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5031-Insertion-8 (Length: 259)
Name: NF5031-Insertion-8
Description: NF5031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5031-Insertion-8 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 109 - 259
Target Start/End: Original strand, 46556986 - 46557136
Alignment:
| Q |
109 |
gattggttctgtatcaggccataactcagctcgtttaccggtttgtgttagtatcttaatcagtgtatcggtgtcgacagtcccctttacttctactttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46556986 |
gattggttctgtatcaggccataactcagctcgtttaccggtttgtgttagtatcttaatcagtgtatcggtgtcgacagtcccctttacttctactttt |
46557085 |
T |
 |
| Q |
209 |
tgttgcttcaaatcaatagttgtttgataaacacccgatttaacaacaata |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46557086 |
tgttgcttcaaatcaatagttgtttgataaacacctgatttaacaacaata |
46557136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University