View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5031_high_9 (Length: 219)
Name: NF5031_high_9
Description: NF5031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5031_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 22 - 144
Target Start/End: Original strand, 17032018 - 17032140
Alignment:
| Q |
22 |
cctctgcacgacctcacctctggctcttcggcgtcagtggctttaggaggtttaactgtttttagtggtgtctcacggtggtccgtggcaagtcacgacg |
121 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
17032018 |
cctccgcaccacctcacctctggctcttcggcgtcagtggctttaggaggtttaattgtttttagtggtgtctcacggtggtccgtggcaagtcacggcg |
17032117 |
T |
|
| Q |
122 |
gtttcgtgggctgttgtttttgc |
144 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
17032118 |
gtttcgtgggctgttgtttttgc |
17032140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University