View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5032-Insertion-13 (Length: 118)
Name: NF5032-Insertion-13
Description: NF5032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5032-Insertion-13 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 2e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 2e-47
Query Start/End: Original strand, 7 - 118
Target Start/End: Complemental strand, 9854838 - 9854727
Alignment:
| Q |
7 |
agttcaaccatggtccttatagcgacatttgttgttctttgaaggacagttgtgagtgcttgctctttggaagatttgtggcacggaccatgttggttgt |
106 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9854838 |
agttcaaccattgtccttatagcgatatttgttgttctttgaaggacagttgtgagtgcttgctctttggaagatttgtgccacggaccatgttggttgt |
9854739 |
T |
|
| Q |
107 |
tcatctaattgg |
118 |
Q |
| |
|
||| |||||||| |
|
|
| T |
9854738 |
tcacctaattgg |
9854727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 15 - 109
Target Start/End: Original strand, 23213942 - 23214036
Alignment:
| Q |
15 |
catggtccttatagcgacatttgttgttctttgaaggacagttgtgagtgcttgctctttggaagatttgtggcacggaccatgttggttgttca |
109 |
Q |
| |
|
|||||||||| ||| || | |||| || ||||||||| |||||||| || |||||| ||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
23213942 |
catggtccttttagggatagttgtagtcttttgaaggatagttgtgattgtttgctccttggattatttgtgccatggaccatgttggttgttca |
23214036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University