View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5032_low_2 (Length: 374)
Name: NF5032_low_2
Description: NF5032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5032_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 287
Target Start/End: Original strand, 9854833 - 9855102
Alignment:
| Q |
18 |
tgaacttccaagacaattatccaagtaaaggtacaatggcctacaccctaaatattaaacatccactataaacagtgactcttcacaaatatacttatca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9854833 |
tgaacttccaagacaattatccaagtaaaggtacaagggcctacaccctaaacattaaacatccactataaacagtggctcttcacaaatatacttatca |
9854932 |
T |
|
| Q |
118 |
tttcacagtcaccgaccattaacgttggatcgcgtgtaagtacatcaccccttaattttctaggagaaaaaggttgtgggcttcggaaaagaaggcaaca |
217 |
Q |
| |
|
||||||| | |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9854933 |
tttcacacttaccgaccattaacgttcgatcgcgtgtaagtacatcaccccttaattttctaggagaaaaaggttgtgggcttcggagaagaaggcaaca |
9855032 |
T |
|
| Q |
218 |
tctgacaacagtgtcctactcgaaagtcattcaatgtcaacaatccaaggatctcatgttcggcatgatc |
287 |
Q |
| |
|
||| || | |||||||||||| ||||||||| ||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
9855033 |
tctaacgaaagtgtcctactcaaaagtcatttaatgtcaacaatccaaggatctcatgtccgacatgatc |
9855102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 327 - 360
Target Start/End: Original strand, 9855142 - 9855175
Alignment:
| Q |
327 |
cttcttaactttgcacctttatttatgtaatgat |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9855142 |
cttcttaactttgcacctttatttatgtaatgat |
9855175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University