View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5032_low_7 (Length: 249)
Name: NF5032_low_7
Description: NF5032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5032_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 246
Target Start/End: Original strand, 3910540 - 3910767
Alignment:
| Q |
19 |
agtctagtttctaaaacattactataaactnnnnnnnngtacctattggaatgaggaaactgaagcatgatgtgcatcttattgtatcaggttgttgcac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3910540 |
agtctagtttctaaaacattactataaactaaaaaaaagtacctattggaatgaggaaactgaagcatgatgtgcatcttattgtatcaggttgttgcac |
3910639 |
T |
 |
| Q |
119 |
aggttgaatgtagatcttttgaatgtacaccttttggatacaaacattacaattaggacagtagaatccatgtgttggtggtttctcaaacaccttttcc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3910640 |
aggttgaatgtagatcttttgaatgtacaccttttggatacaaacattacagttaggacaatagaatccatgtgttggtggtttctcaaacaccttttcc |
3910739 |
T |
 |
| Q |
219 |
aaataaaattcttgtctttcttggccat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
3910740 |
aaataaaattcttgtctttcttggccat |
3910767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University