View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5033_low_10 (Length: 239)
Name: NF5033_low_10
Description: NF5033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5033_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 49991388 - 49991162
Alignment:
| Q |
1 |
catccatcaccaataaggaatgagttttagcctatgtttgattccatgtttcgttctatcataattgattatgcaagtgtaaagttgattttggtatatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49991388 |
catccatcaccaataaggaatgagttttagcctatgtttgattccatgtttcgttctatcataattgattatggaagtgtaaagttgattttggtatatt |
49991289 |
T |
 |
| Q |
101 |
tggtttcatgcgtgtttttgctaagtttttggta----ctagttgttaggctgttgaaagtttgctctttgcttaggcttgctgttagtttcttttcagc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| ||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
49991288 |
tggtttcatgcgtgtttttgctaagtttttggtagttgttacttgttaggctgttggaagtttgctgtttgcttaggcttgctgtaagtttcttttcagc |
49991189 |
T |
 |
| Q |
197 |
tgttataaggtattggtctgtgctcct |
223 |
Q |
| |
|
||||||||||| ||||| ||||||||| |
|
|
| T |
49991188 |
tgttataaggtgttggtttgtgctcct |
49991162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 102 - 222
Target Start/End: Original strand, 52490002 - 52490118
Alignment:
| Q |
102 |
ggtttcatgcgtgtttttgctaagtttttggtactagttgttaggctgttgaaagtttgctctttgcttaggcttgctgttagtttcttttcagctgtta |
201 |
Q |
| |
|
||||||||| ||||||| ||| |||||| | |||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52490002 |
ggtttcatgtgtgttttcgctcagttttgg----tagttgttaggccgttgaaagtttgctgtttgcttaggcttgctgttagtttcttttcagctgtta |
52490097 |
T |
 |
| Q |
202 |
taaggtattggtctgtgctcc |
222 |
Q |
| |
|
|||||| ||||| |||||||| |
|
|
| T |
52490098 |
taaggtgttggtttgtgctcc |
52490118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University