View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5033_low_5 (Length: 380)
Name: NF5033_low_5
Description: NF5033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5033_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 17 - 370
Target Start/End: Original strand, 48248204 - 48248560
Alignment:
| Q |
17 |
aattacaaactctgaattcttctcccacaggagctactactactattcc------attcccacgtttcaaacaagaagaaaatcaagatcaagaacgtga |
110 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48248204 |
aattacaaactcttaattcttctcccacaggagctactactactattcctattccattcccacgtttcaaacaagaagaaaatcaaga------acgtga |
48248297 |
T |
 |
| Q |
111 |
gtctttggttaaaaagaaacgatcaaaacgaccgcgtattggta------acccacccactgaagaagaatatcttgctctctgtctcatcatgctctca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48248298 |
gtctttggttaaaaagaaacgatcaaaacgaccgcgtattggtattggtaacccacccactgaagaagaatatcttgctctctgtctcatcatgctctca |
48248397 |
T |
 |
| Q |
205 |
caaagcaacaaacaaattgaatcatcaccgttgaagcagctcaatcacaagtgcagtgtttgtaacaaagcttttccatcttatcaagcacttggtggtc |
304 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48248398 |
caaagcaacaaccaaattcaatcatcaccgttgaagc---tcaatcacaagtgcagtgtttgcaacaaagcttttccatcttatcaagcacttggtggtc |
48248494 |
T |
 |
| Q |
305 |
acaaagccagccaccgcaaatcttcatcggaaaaccaatccacaaccgtcaacgagaccgtctctg |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48248495 |
acaaagccagccaccgcaaatcttcatcggaaaaccaatccacaaccgtcaacgagaccatctctg |
48248560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 200
Target Start/End: Original strand, 5294569 - 5294607
Alignment:
| Q |
162 |
cactgaagaagaatatcttgctctctgtctcatcatgct |
200 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
5294569 |
cactgaagaagaatatctcgctctttgtctcatcatgct |
5294607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 320
Target Start/End: Complemental strand, 47436080 - 47436028
Alignment:
| Q |
268 |
aacaaagcttttccatcttatcaagcacttggtggtcacaaagccagccaccg |
320 |
Q |
| |
|
|||||||||||| ||||||||||||| || ||||| ||||||||||| ||||| |
|
|
| T |
47436080 |
aacaaagctttttcatcttatcaagccctaggtggacacaaagccagtcaccg |
47436028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University