View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5033_low_9 (Length: 290)
Name: NF5033_low_9
Description: NF5033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5033_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 20 - 275
Target Start/End: Complemental strand, 49085271 - 49085016
Alignment:
| Q |
20 |
atgagaactcgtgtctctaagcccgtcgtggtgatcgttattcatagaactttcaaggttgttcttgcctacaatagttgaaggggcatttccatcactt |
119 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49085271 |
atgagaactcgtgtctctaagcccgtcatggtgatcgttattcatagaactttcaaggttgttcttgcctacaatagttgaaggggcatttccatcactt |
49085172 |
T |
|
| Q |
120 |
acgctgcctaggccttcacacacaccactggcgttatgactctccgcgtcatggtaaaaactggtacaactttgaatattagatggagagtcatgcatag |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
49085171 |
acgctgcctaggccttcacacacaccactggcgttatgactctccgcgtcatggtaaaaactggtacaactttgaccattagatggagattcatgcatag |
49085072 |
T |
|
| Q |
220 |
caaaatcattattgctttgatcacaagtataggtggcatcatccgaccagtgatga |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49085071 |
caaaatcattattgctttgatcacaagtataggtggcatcatccgaccagtgatga |
49085016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University