View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5034_high_24 (Length: 220)

Name: NF5034_high_24
Description: NF5034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5034_high_24
NF5034_high_24
[»] chr4 (1 HSPs)
chr4 (9-215)||(46951538-46951746)


Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 9 - 215
Target Start/End: Complemental strand, 46951746 - 46951538
Alignment:
9 cataattcatctcagtgcgttaacttga--agtaattaaaatgtgcacataatccaaaaattcacttagatagagagtattatgttattataaataaagg 106  Q
    ||||||||||||| ||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46951746 cataattcatctcggtgcgttaacttgagaagtaattaaaatgtgcacataatccaaaaattcacttagatagagagtattatgttattataaataaagg 46951647  T
107 gaagaacctaaatacaataacatgttcacaaaatggaggatcttgactcgttcgtttgatgcgaaaatatctcaaaattcatgattgtgtgttcccaaag 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
46951646 gaagaacctaaatacaataacatgttcacaaaatggaggatcttgactcgttcgtttgatgcgaaaatatctcaacattcatgattgtgtgttcccaaag 46951547  T
207 aataattta 215  Q
    |||||||||    
46951546 aataattta 46951538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University