View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5034_low_19 (Length: 245)
Name: NF5034_low_19
Description: NF5034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5034_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 19354583 - 19354802
Alignment:
| Q |
18 |
atatcatt-tctcttgagacaaacctcgaagttgttatatggtcattactttttatattctacgtgtttctcaagcgttctattaattattattttttca |
116 |
Q |
| |
|
|||||||| ||| |||||| |||||||||||||||||||||| ||||||||| | ||||||||||||||||| | |||| ||||||||||||||||||| |
|
|
| T |
19354583 |
atatcattatctattgagataaacctcgaagttgttatatggctattacttttcacattctacgtgtttctcacgtgttcgattaattattattttttca |
19354682 |
T |
 |
| Q |
117 |
aaacactctttgtctggattatataatcagaactcctacaaaagaattttcgaattatataatctgaaccatgtggaaaatccagaaaatggctttgtac |
216 |
Q |
| |
|
|| ||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
19354683 |
aa-cactctttgtccggattatataatcagaactcctacaaaagaatttttgaattatataatctgaaccatg-cgaaaacccagaaaatggctttgtac |
19354780 |
T |
 |
| Q |
217 |
ttgataacaaaagtctctgctg |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
19354781 |
ttgataacaaaagtctctgctg |
19354802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University