View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5034_low_20 (Length: 240)
Name: NF5034_low_20
Description: NF5034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5034_low_20 |
 |  |
|
| [»] scaffold0088 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0088 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 154 - 224
Target Start/End: Original strand, 47861 - 47931
Alignment:
| Q |
154 |
tttattgtttttattctgaaaaagagcaaagaaatggttgtcacaaagatgtttgtataaatatattcaaa |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
47861 |
tttattgtttttattctgaaaaagagcaaagaaatggttgtcacaaagatggttgtataaacatattcaaa |
47931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 17 - 63
Target Start/End: Original strand, 47817 - 47863
Alignment:
| Q |
17 |
atactcatatgatgttgtctaatttcgtggtgtttttacacccattt |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47817 |
atactcatatgatgttgtctaatttcgtggtgtttttacacccattt |
47863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University