View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5034_low_24 (Length: 220)
Name: NF5034_low_24
Description: NF5034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5034_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 9 - 215
Target Start/End: Complemental strand, 46951746 - 46951538
Alignment:
| Q |
9 |
cataattcatctcagtgcgttaacttga--agtaattaaaatgtgcacataatccaaaaattcacttagatagagagtattatgttattataaataaagg |
106 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46951746 |
cataattcatctcggtgcgttaacttgagaagtaattaaaatgtgcacataatccaaaaattcacttagatagagagtattatgttattataaataaagg |
46951647 |
T |
 |
| Q |
107 |
gaagaacctaaatacaataacatgttcacaaaatggaggatcttgactcgttcgtttgatgcgaaaatatctcaaaattcatgattgtgtgttcccaaag |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46951646 |
gaagaacctaaatacaataacatgttcacaaaatggaggatcttgactcgttcgtttgatgcgaaaatatctcaacattcatgattgtgtgttcccaaag |
46951547 |
T |
 |
| Q |
207 |
aataattta |
215 |
Q |
| |
|
||||||||| |
|
|
| T |
46951546 |
aataattta |
46951538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University