View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5035_high_6 (Length: 235)

Name: NF5035_high_6
Description: NF5035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5035_high_6
NF5035_high_6
[»] chr5 (1 HSPs)
chr5 (18-143)||(1917401-1917526)
[»] chr1 (1 HSPs)
chr1 (20-138)||(29121038-29121156)
[»] chr8 (1 HSPs)
chr8 (28-143)||(44515732-44515846)


Alignment Details
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 18 - 143
Target Start/End: Original strand, 1917401 - 1917526
Alignment:
18 agcatgtctcattggtgtctgaatccgagggcatgtctaggcgatatgaagacttgaactttcagcattgttgttttggtgtttctgatccttgtctgca 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |    
1917401 agcatgtctcattggtgtctgaatccgagggcatgtctaggcgatatgaagacttgaactttcagcattgttgtcttggtgtttctgatccttgtctgta 1917500  T
118 tgagtagaagtataggtgtccgtctc 143  Q
    |||||||||||| |||||||||||||    
1917501 tgagtagaagtacaggtgtccgtctc 1917526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 20 - 138
Target Start/End: Complemental strand, 29121156 - 29121038
Alignment:
20 catgtctcattggtgtctgaatccgagggcatgtctaggcgatatgaagacttgaactttcagcattgttgttttggtgtttctgatccttgtctgcatg 119  Q
    ||||||||| |||||| ||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||  ||    
29121156 catgtctcactggtgtttgaatccgagggcgtgtctaggcgatatgaagacttgaattttcagcattgttgtcttggtgtttctgatccttgtctgtttg 29121057  T
120 agtagaagtataggtgtcc 138  Q
    || ||||||| ||||||||    
29121056 agcagaagtacaggtgtcc 29121038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 28 - 143
Target Start/End: Original strand, 44515732 - 44515846
Alignment:
28 attggtgtctgaatccgagggcatgtctaggcgatatgaagacttgaactttcagcattgttgttttggtgtttctgatccttgtctgcatgagtagaag 127  Q
    |||||||||||||||||||||  |||||||| |||||||||||||||| ||||||   |||||| || ||| ||||||||| | ||||  |||| ||||     
44515732 attggtgtctgaatccgagggt-tgtctaggtgatatgaagacttgaattttcagtgatgttgtcttagtgattctgatccgtttctgtttgagcagaat 44515830  T
128 tataggtgtccgtctc 143  Q
    |||||| ||| |||||    
44515831 tataggcgtctgtctc 44515846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University