View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5035_high_6 (Length: 235)
Name: NF5035_high_6
Description: NF5035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5035_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 18 - 143
Target Start/End: Original strand, 1917401 - 1917526
Alignment:
| Q |
18 |
agcatgtctcattggtgtctgaatccgagggcatgtctaggcgatatgaagacttgaactttcagcattgttgttttggtgtttctgatccttgtctgca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
1917401 |
agcatgtctcattggtgtctgaatccgagggcatgtctaggcgatatgaagacttgaactttcagcattgttgtcttggtgtttctgatccttgtctgta |
1917500 |
T |
|
| Q |
118 |
tgagtagaagtataggtgtccgtctc |
143 |
Q |
| |
|
|||||||||||| ||||||||||||| |
|
|
| T |
1917501 |
tgagtagaagtacaggtgtccgtctc |
1917526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 20 - 138
Target Start/End: Complemental strand, 29121156 - 29121038
Alignment:
| Q |
20 |
catgtctcattggtgtctgaatccgagggcatgtctaggcgatatgaagacttgaactttcagcattgttgttttggtgtttctgatccttgtctgcatg |
119 |
Q |
| |
|
||||||||| |||||| ||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
29121156 |
catgtctcactggtgtttgaatccgagggcgtgtctaggcgatatgaagacttgaattttcagcattgttgtcttggtgtttctgatccttgtctgtttg |
29121057 |
T |
|
| Q |
120 |
agtagaagtataggtgtcc |
138 |
Q |
| |
|
|| ||||||| |||||||| |
|
|
| T |
29121056 |
agcagaagtacaggtgtcc |
29121038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 28 - 143
Target Start/End: Original strand, 44515732 - 44515846
Alignment:
| Q |
28 |
attggtgtctgaatccgagggcatgtctaggcgatatgaagacttgaactttcagcattgttgttttggtgtttctgatccttgtctgcatgagtagaag |
127 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||||||||||| |||||| |||||| || ||| ||||||||| | |||| |||| |||| |
|
|
| T |
44515732 |
attggtgtctgaatccgagggt-tgtctaggtgatatgaagacttgaattttcagtgatgttgtcttagtgattctgatccgtttctgtttgagcagaat |
44515830 |
T |
|
| Q |
128 |
tataggtgtccgtctc |
143 |
Q |
| |
|
|||||| ||| ||||| |
|
|
| T |
44515831 |
tataggcgtctgtctc |
44515846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University