View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5036-Insertion-3 (Length: 468)
Name: NF5036-Insertion-3
Description: NF5036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5036-Insertion-3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 54 - 277
Target Start/End: Original strand, 4717246 - 4717469
Alignment:
| Q |
54 |
gagtgcaactgcactgttcacggcaaattatgtcaaattctcttcccctctgtctcccgacacctcatgaagcataaatctccattcatcaatctaatct |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4717246 |
gagtgcaactgcactgttcacggcaaattatgtcaaattctcttcccctctgtctcccgacacctcatgaagcataaatctccattcatcaatctaacct |
4717345 |
T |
|
| Q |
154 |
tcatataatttcttccattttcttctttgttgttagattgttaatttaggtttagtttgttcattgtgtggtgttagaacccacctaaaaaatcgatttc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
4717346 |
tcatataatttcttccattttcttctttgttgttagattgttaatttaggtttagtttgttgattgtgtgctgttagaacccacctaaaaaatagatttc |
4717445 |
T |
|
| Q |
254 |
aatgttttgtaacttaaatatgaa |
277 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
4717446 |
aatgttttggaacttaaatatgaa |
4717469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University