View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5036-Insertion-4 (Length: 461)
Name: NF5036-Insertion-4
Description: NF5036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5036-Insertion-4 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 442; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 442; E-Value: 0
Query Start/End: Original strand, 8 - 461
Target Start/End: Complemental strand, 41720587 - 41720134
Alignment:
| Q |
8 |
ggtggtggagacaccggacgtgtgttacgttcagggcggcagttatggccggattccggcaacgtctccgacgatcggaggaagaaaccggcaaagacaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41720587 |
ggtggtggagacaccggacgtgtgttacggtcagggcggcagttatggccggattccggcaacgtctccgacgatcggaggaagaaaccggcgaagacaa |
41720488 |
T |
|
| Q |
108 |
atctgcataacgacgggagtgataggttttacggaaaaatgtatagcagaaagaggaaaagaaacgttgaaaacaacgaaagtaagattgtcaggtttca |
207 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41720487 |
atcttcataacgacgggagtgataggttttacggaaaaatgtatagcagaaagaggaaaagaaacgttgaaaacaacgaaagtaagattgtcaggtttca |
41720388 |
T |
|
| Q |
208 |
acgacaaaggatgaaggatccatgtaagattgcggttattgtgaaaccttgttctgaggatattggtttgttttcgtgttttttgtttctggtgttgaga |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41720387 |
acgacaaaggatgaaggatccatgtaagattgcggttattgtgaaaccttgttctgaggatattggtttgttttcgtgttttttgtttctggtgttgaga |
41720288 |
T |
|
| Q |
308 |
accgttgtgatgttcggtctcacattcgaggatctcgctgcttttgttctgtcagagcctatttgttctgtttatgcttcaagagggatacaattcttac |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41720287 |
accgttgtgatgttcggtctcacattcgaggatctcgctgcttttgttctgtcagagcctatttgttctgtttatgcttcaagagggatacaattcttac |
41720188 |
T |
|
| Q |
408 |
aggtaaaaatcttagtccttgaattatgctaaagtttgtctctgatgtttttta |
461 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41720187 |
aggtaaaaatcttagtccttgaattatgctaaagtttgtctctgatgtttttta |
41720134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University