View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5036-Insertion-8 (Length: 165)
Name: NF5036-Insertion-8
Description: NF5036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5036-Insertion-8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 8e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 8e-78
Query Start/End: Original strand, 11 - 165
Target Start/End: Original strand, 43907007 - 43907161
Alignment:
| Q |
11 |
aagacaagattagaaacaataaggaagaagcgaaacgcagtgcaaaaatttcttacgaaagatcttgttgatcttctcaagaattctcttgaatacaacg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43907007 |
aagacaagattagaaacaataaggaagaagcgaaacgcagtgcaaaaatttcttaagaaagatcttgttgatcttctcaagaattctcttgaatacaatg |
43907106 |
T |
|
| Q |
111 |
catatggaagggtaatctttaactttcttgtaaattttgattcattcttaattaa |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43907107 |
catatggaagggtaatctttaactttcttgtaaattttgattcattcttaattaa |
43907161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University