View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5038-Insertion-11 (Length: 80)
Name: NF5038-Insertion-11
Description: NF5038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5038-Insertion-11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 73; Significance: 5e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 5e-34
Query Start/End: Original strand, 8 - 80
Target Start/End: Original strand, 39952036 - 39952108
Alignment:
| Q |
8 |
gttaaaatatgtattagatttaaattatgttgagcaaatatctcttgattatgtttgttgatttttctccctg |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39952036 |
gttaaaatatgtattagatttaaattatgttgagcaaatatctcttgattatgtttgttgatttttctccctg |
39952108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 2e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 2e-24
Query Start/End: Original strand, 8 - 80
Target Start/End: Complemental strand, 34230525 - 34230453
Alignment:
| Q |
8 |
gttaaaatatgtattagatttaaattatgttgagcaaatatctcttgattatgtttgttgatttttctccctg |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
34230525 |
gttaaaatatgtattagatttaaattatgttgagtaaatatctcttgattatgtttgttggcttttatccctg |
34230453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University