View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5038-Insertion-15 (Length: 320)
Name: NF5038-Insertion-15
Description: NF5038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5038-Insertion-15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 65 - 320
Target Start/End: Original strand, 9698333 - 9698588
Alignment:
| Q |
65 |
caaaacaaacatggatgttgcagcatgtaattaaattcacatcttctcagttcttgagtcctggcgaatccccggagccctgtcaattggtgttgcagcg |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
9698333 |
caaaacaaacatggatgttgcagcatgtaattaaattcacatcttctcagttcttgagtcctggcgaatccccggagccctgtcatttggtgttgcagtg |
9698432 |
T |
 |
| Q |
165 |
agttcactctctcttccatcctcacccgaaatctcttccaaagatcgtcccttagtttccgtcaccaagaacgtgcaaaagaatcctatcaaatttgtaa |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9698433 |
agttcactctctcttccatcctcacccgaaatctcttccaaagatcgtcccttagtttccgtcaccaagaacgtgcaaaagaatcctatcaaatttgtaa |
9698532 |
T |
 |
| Q |
265 |
aagccagaatcatcattgcgcgtctaatcttccttggcgtaccatccaacgtgtag |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9698533 |
aagccagaatcatcattgcgcgtctaatcttccttggcgtaccatccaacgtgtag |
9698588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University