View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5038-Insertion-7 (Length: 546)
Name: NF5038-Insertion-7
Description: NF5038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5038-Insertion-7 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 3e-71; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 3e-71
Query Start/End: Original strand, 391 - 546
Target Start/End: Original strand, 23045796 - 23045951
Alignment:
| Q |
391 |
gtgtctatataatttgctacacataaaatgtccaccat-actccattagtactatgtttatatataaatattctagtgacggtcttctttagaagtcaac |
489 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23045796 |
gtgtctatgtaatttgctacacataaaatgtccaccattactccattagtactatgtttatatataaatattctagtgacggtcttctttagaagtcaac |
23045895 |
T |
|
| Q |
490 |
tttgcattgtgatagatttcaatttcaaattggtaactaagttgttattttcaccca |
546 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23045896 |
tttgcattgtgatagatttcaatttcaaattggt-actaagttgttattttcaccca |
23045951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 261 - 330
Target Start/End: Original strand, 23045726 - 23045795
Alignment:
| Q |
261 |
atattgacaaaagacaatacacaaaaaattaaaattgttatctttgtcaatacatagttcacatgtcctt |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23045726 |
atattgacaaaagacaatacacaaaaaattaaaattgttatctttgtcaatacatagttcacatgtcctt |
23045795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 27 - 113
Target Start/End: Original strand, 23045607 - 23045693
Alignment:
| Q |
27 |
actatgaagtagtggagcaacttgtcactaactgacgtggaacttaattagcctaatcgattgataagagcacaattttgtcaaaga |
113 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||| |
|
|
| T |
23045607 |
actatgaagtagtggaccaacttgtcaccaactgacgtggaacttaattagcctaatcaatttataagagcacaattttgtctaaga |
23045693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University