View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5038-Insertion-9 (Length: 168)
Name: NF5038-Insertion-9
Description: NF5038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5038-Insertion-9 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 5e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 5e-79
Query Start/End: Original strand, 8 - 168
Target Start/End: Complemental strand, 4823259 - 4823099
Alignment:
| Q |
8 |
acttcgtggctgaggtgacggagttcataaggaatgtcaattcgatctctactctcgccactaacatttgccgtttctaaaatccgtgctcccagaaata |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4823259 |
acttcgtggctgaggtgacggagttcataaggaatgtcaattcgatctctactatcgccactaacattttccgtttctaaaatccgtgctcccagaaata |
4823160 |
T |
|
| Q |
108 |
ttaaaacttggacttcatagtcattgtcaaagactttatggacaaaacttaggttctgaga |
168 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4823159 |
tcaaaacttggacttcatagtcattgtcaaagactttatggacaaaacttaggttctgaga |
4823099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University