View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5038_high_11 (Length: 241)
Name: NF5038_high_11
Description: NF5038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5038_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 230
Target Start/End: Complemental strand, 4410813 - 4410601
Alignment:
| Q |
18 |
ttatcattccctaaactcatagaaagttccatactactacatgaggcttgttccaaacctgatcttgttccattcatgctatgagttaagtctgaacaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4410813 |
ttatcattccctaaactcatagaaagttccatactactacatgaggcttgttccaaacctgatcttgttccattcatgctatgagttaagtcagaacaac |
4410714 |
T |
 |
| Q |
118 |
taatctctgagcattgacctgaagttggagatgttgcaagacttagtgaaagctcattgctacaattcgaggaactataagcgagattcgttaagttagc |
217 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4410713 |
taatctctgagcattgaactgaagttggagatgttgcaagacttagtgaaagctcattgctacaattcgaggaactataagcgagattcgttaagttagc |
4410614 |
T |
 |
| Q |
218 |
aacatttgatgat |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4410613 |
aacatttgatgat |
4410601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University