View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5038_high_13 (Length: 237)
Name: NF5038_high_13
Description: NF5038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5038_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 14 - 222
Target Start/End: Original strand, 26255309 - 26255517
Alignment:
| Q |
14 |
atgaacgccggcaaggacacagaaacaacgtcaaacagtaacagcaagctgcggttccatacagtatcacacttcaccgtctttcccggtcaaccacggt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
26255309 |
atgaacgccggcaaggacacagaaacaacgtcaaacagtgacagcaagctaaggttccatacagtatcacacttcaccgtgtttcccggtcaaccaaggt |
26255408 |
T |
 |
| Q |
114 |
ggccggagggaaagcaggagctaacctacgcgttcttccctggtaacgaacttacagaaaccgtgaaaagcgtcttcgcaacagcgtttgcacggtggtc |
213 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26255409 |
ggccggagggaaagcaggaactaacctacgcgttcttccccggtaacgaacttacagaaaccgtgaaaagcgtcttcgcaacagcgtttgcacgatggtc |
26255508 |
T |
 |
| Q |
214 |
ggaggtcac |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
26255509 |
ggaggtcac |
26255517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University