View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5038_low_11 (Length: 242)
Name: NF5038_low_11
Description: NF5038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5038_low_11 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 16 - 242
Target Start/End: Original strand, 34976683 - 34976909
Alignment:
| Q |
16 |
aagccaactctgggggtattgtgaaaatggcattttcacccttcttcatggttttgataccttcatcccaccctttgatcacttgcccttcattgacaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34976683 |
aagccaactctgggggtattgtgaaaatggcattttcacccttcttcatggttttgataccttcatcccaccctttgatcacttgcccttcattgacaaa |
34976782 |
T |
 |
| Q |
116 |
aacaataacaaattaactgcagttcattgatgaagtaaagtcctaagagatctcagtctttggataaagttttatgaaacagagacacggatgttggaca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
34976783 |
aacaataacaaattaactgcagttcattgatgaagtaaagtcctaagagatctcagtcttcggatgaagttttatgaaacagagacacggatgttggaaa |
34976882 |
T |
 |
| Q |
216 |
cgataaaacactgacaatgaaaataat |
242 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
34976883 |
cgataaaacactgacaatgaaaataat |
34976909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 36 - 104
Target Start/End: Original strand, 3496420 - 3496488
Alignment:
| Q |
36 |
gtgaaaatggcattttcacccttcttcatggttttgataccttcatcccaccctttgatcacttgccct |
104 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| || || |||||||| ||||| || ||||||||| |
|
|
| T |
3496420 |
gtgaaaagagcattttcacctttcttcatggttttaattccctcatcccatcctttaataacttgccct |
3496488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 104
Target Start/End: Original strand, 18848995 - 18849054
Alignment:
| Q |
45 |
gcattttcacccttcttcatggttttgataccttcatcccaccctttgatcacttgccct |
104 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||| |||| || ||||||||| |
|
|
| T |
18848995 |
gcattttcacctttcttcatggttttaataccttcatcccatccttgaattacttgccct |
18849054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University