View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039-Insertion-20 (Length: 231)
Name: NF5039-Insertion-20
Description: NF5039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039-Insertion-20 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 8 - 231
Target Start/End: Complemental strand, 42377136 - 42376913
Alignment:
| Q |
8 |
caagaatcagcatctacaaagcaaacaacaagaaacatcctctgaaaattgttcctcaaacatggattctgttaaggttgttgatgatgtctccatcaca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42377136 |
caagaatcagcatctacaaagcaaacaacaagaaacatcctctgaaaattgttcctcaaacatggattctgttaaggttgttgatgatgtctccatcaca |
42377037 |
T |
|
| Q |
108 |
agtaacagtttatgctcaacgccaaaaggtaaaaaatttcggataccagaaatttccacatgtccaccagcaccaaagaaacaaagggtgctttcaaatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42377036 |
agtaacagtttatgctcaacgccaaaaggtaaaaaatttcggataccagaaatttccacatgtccaccagcaccaaagaaacaaagggtgctttcaaatt |
42376937 |
T |
|
| Q |
208 |
tctctcttcgtcgatcatttttcg |
231 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42376936 |
tctctcttcgtcgatcatttttcg |
42376913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 110 - 207
Target Start/End: Complemental strand, 24578926 - 24578829
Alignment:
| Q |
110 |
taacagtttatgctcaacgccaaaaggtaaaaaatttcggataccagaaatttccacatgtccaccagcaccaaagaaacaaagggtgctttcaaatt |
207 |
Q |
| |
|
||||||| ||| ||||| ||||||||| | |||| | |||||||||| ||||| |||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
24578926 |
taacagtgcatgttcaacaccaaaaggtcagaaatataggataccagagatttcaacatgtcctccagcaccaaagaaacaaagggtagtttcaaatt |
24578829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University