View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039-Insertion-22 (Length: 69)
Name: NF5039-Insertion-22
Description: NF5039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039-Insertion-22 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 54; Significance: 9e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 9e-23
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 26198838 - 26198891
Alignment:
| Q |
16 |
acatgatagtgtgctaatgtatgccctttgcaacatttcatggaaggtaaatga |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26198838 |
acatgatagtgtgctaatgtatgccctttgcaacatttcatggaaggtaaatga |
26198891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University