View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039-Insertion-4 (Length: 273)
Name: NF5039-Insertion-4
Description: NF5039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039-Insertion-4 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 93 - 273
Target Start/End: Original strand, 33731340 - 33731521
Alignment:
| Q |
93 |
tgacacatcgagaagaatcaaattgattcattaatatatgtagtcatataccaaatatttccacgagattcgcgttcaattttgtttattgcaatgaatc |
192 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33731340 |
tgacacatcgtgaagaatcaaattgattcattaatatatgtagtcatataccaaatatttccacgagattcgcgttcaattttgtttattgcaatgaatc |
33731439 |
T |
|
| Q |
193 |
agaaaacaacaaaatttgatactgtcttaagagattacactgacagagtgaat-gtatgaatatatagatgcgtgtgccata |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||||||||| |
|
|
| T |
33731440 |
agaaaacaacaaaatttgatactgtcttaagagattacactgacagagtgaatcttatgattatatagatgcatgtgccata |
33731521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 57
Target Start/End: Original strand, 33731279 - 33731329
Alignment:
| Q |
7 |
attaactcgaataatattaaggaggattttacaatcgtcgcagagagaatt |
57 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||| | |||||| |
|
|
| T |
33731279 |
attaactcgaataatattaatgattattttacaatcgtcgcataaagaatt |
33731329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University