View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_1D_high_15 (Length: 306)
Name: NF5039_1D_high_15
Description: NF5039_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_1D_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 5e-53; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 17 - 126
Target Start/End: Complemental strand, 2618643 - 2618534
Alignment:
| Q |
17 |
atcaatcaccagagtaatacatatgcacattgttgacttttgttgtgatggaatgactacattctaaaatatagaaatgtatatctttatttgaggatct |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2618643 |
atcaatcaccagagtaatacatatgcacattgttgacttttgttgtgatggaatgactatattctaaaatatagaaatgtatatctttatttgaggatct |
2618544 |
T |
 |
| Q |
117 |
tttaattgta |
126 |
Q |
| |
|
|||||||||| |
|
|
| T |
2618543 |
tttaattgta |
2618534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 249 - 306
Target Start/End: Original strand, 2618711 - 2618768
Alignment:
| Q |
249 |
aaaatattttttccaatgtaaaatgcagaagaaactgtggtgcagattgaaggttgtg |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2618711 |
aaaatattttttccaatgtaaaatgcagaagaaactgtggtgcagattgaaggttgtg |
2618768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 218 - 306
Target Start/End: Original strand, 2630390 - 2630477
Alignment:
| Q |
218 |
gagtgttagaaattcaatatactgattaagaaaaatattttttccaatgtaaaatgcagaagaaactgtggtgcagattgaaggttgtg |
306 |
Q |
| |
|
|||||||| | |||||||||| |||||| |||||||| ||| ||| ||||||| |||||||||| |||||||||| ||||||||||||| |
|
|
| T |
2630390 |
gagtgttatagattcaatatattgattatgaaaaatagtttatcctatgtaaa-tgcagaagaagctgtggtgcaaattgaaggttgtg |
2630477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 268 - 306
Target Start/End: Original strand, 2632373 - 2632411
Alignment:
| Q |
268 |
aaaatgcagaagaaactgtggtgcagattgaaggttgtg |
306 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
2632373 |
aaaatgcagaagaagctgtggtgcaaattgaaggttgtg |
2632411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 306
Target Start/End: Original strand, 2624165 - 2624202
Alignment:
| Q |
269 |
aaatgcagaagaaactgtggtgcagattgaaggttgtg |
306 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
2624165 |
aaatgcagaagaagctgtggtgaagattgaaggttgtg |
2624202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University