View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_1D_high_17 (Length: 279)
Name: NF5039_1D_high_17
Description: NF5039_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_1D_high_17 |
 | |
|
| [»] scaffold0432 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-118; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 32 - 267
Target Start/End: Complemental strand, 9804910 - 9804675
Alignment:
| Q |
32 |
ttgcccaaataatgaaacgaggttgaagtttcatgaaaactccatcaaaagagataaccattcatgagaggttggcaacggcgactggtcgatgtcgatc |
131 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9804910 |
ttgcccaaataatgaaacgaggttgaactttcatgaaaactccatcaaaagagataaccattcatgagaggttggcaacggcgactgatcgatgtcgatc |
9804811 |
T |
|
| Q |
132 |
tcagtgaagtttcatggttcttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgttt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
9804810 |
tcagtgaagtttcatggttcttttttctgatcgatgtcgatctcagtgatggtgcttggagagaggttggcaacagcgattgagggagaaaattgtgttt |
9804711 |
T |
|
| Q |
232 |
agggtttcaagagaatgagaaatgaggatgggagga |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
9804710 |
agggtttcaagagaatgagaaatgaggatgggagga |
9804675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 152 - 279
Target Start/End: Complemental strand, 9817693 - 9817566
Alignment:
| Q |
152 |
ttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatgaga |
251 |
Q |
| |
|
|||||||||||||||||||||||||| ||| || |||||||||||||| |||||||| |||||| ||||||| ||||||||||||||||| ||||||| |
|
|
| T |
9817693 |
ttttttctgatcgatgtcgatctcagcaatgttggtaggagagaggttgtcaacggcggatgagggggaaaattgtgtttagggtttcaagataatgaga |
9817594 |
T |
|
| Q |
252 |
aatgaggatgggaggattattttgtttg |
279 |
Q |
| |
|
|||||||||||||||||| ||||||||| |
|
|
| T |
9817593 |
aatgaggatgggaggattcttttgtttg |
9817566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 149 - 275
Target Start/End: Complemental strand, 9817577 - 9817451
Alignment:
| Q |
149 |
ttcttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatg |
248 |
Q |
| |
|
||||||| | |||| ||||||||||||| |||||| ||||||||||||||||| | ||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
9817577 |
ttcttttgtttgattgatgtcgatctcacctatggtggtaggagagaggttggcagcagcggctgagggagaaaactttgtttagggtttcaaaagaatg |
9817478 |
T |
|
| Q |
249 |
agaaatgaggatgggaggattattttg |
275 |
Q |
| |
|
|||||||||||| |||||||| ||||| |
|
|
| T |
9817477 |
agaaatgaggattggaggattcttttg |
9817451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 159 - 267
Target Start/End: Complemental strand, 9817448 - 9817341
Alignment:
| Q |
159 |
tgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatgagaaatgagg |
258 |
Q |
| |
|
||||||||||||||| ||| ||||||| || |||||||||||||| ||||| |||||||||||| | ||||||||||||| |||||||||||||||||| |
|
|
| T |
9817448 |
tgatcgatgtcgatc-cagcgatggtggtatgagagaggttggcagcggcggctgagggagaaaactgtgtttagggtttctagagaatgagaaatgagg |
9817350 |
T |
|
| Q |
259 |
atgggagga |
267 |
Q |
| |
|
||||||||| |
|
|
| T |
9817349 |
atgggagga |
9817341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 30 - 91
Target Start/End: Complemental strand, 9817838 - 9817777
Alignment:
| Q |
30 |
ttttgcccaaataatgaaacgaggttgaagtttcatgaaaactccatcaaaagagataacca |
91 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9817838 |
ttttgcccaaataatggaacgaggttgaagtttcatgaaaattccatcaaaagagataacca |
9817777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: scaffold0432
Description:
Target: scaffold0432; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 145 - 279
Target Start/End: Complemental strand, 11708 - 11574
Alignment:
| Q |
145 |
atggttcttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagag |
244 |
Q |
| |
|
|||||||||||||| |||||||| |||||||| ||||||| || |||||||||||| | ||| ||||| || |||| ||||||| | | |||||||| |
|
|
| T |
11708 |
atggttcttttttccaatcgatgttgatctcagcgatggtggtatgagagaggttggtagcgggagttgagagataaaactttgttttgagattcaagag |
11609 |
T |
|
| Q |
245 |
aatgagaaatgaggatgggaggattattttgtttg |
279 |
Q |
| |
|
|||| ||| |||||||||||||||| ||||||||| |
|
|
| T |
11608 |
aatgggaagtgaggatgggaggattcttttgtttg |
11574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 33 - 88
Target Start/End: Complemental strand, 11843 - 11788
Alignment:
| Q |
33 |
tgcccaaataatgaaacgaggttgaagtttcatgaaaactccatcaaaagagataa |
88 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11843 |
tgcccaattaatgaaacgaggttgaagtttcatgaaaactccatcaaaagagataa |
11788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 149 - 267
Target Start/End: Complemental strand, 11585 - 11467
Alignment:
| Q |
149 |
ttcttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatg |
248 |
Q |
| |
|
||||||| | ||||| ||||||||||||| | | ||| ||| ||||||||||||| || || ||||||||||| | ||| | || ||||| |||||| |
|
|
| T |
11585 |
ttcttttgtttgatcaatgtcgatctcagcggtagtggtagaagagaggttggcagcgacggccgagggagaaaactgtgtgtgggatttcatgagaata |
11486 |
T |
|
| Q |
249 |
agaaatgaggatgggagga |
267 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
11485 |
agaaatgaggatgggagga |
11467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 91
Target Start/End: Original strand, 42778840 - 42778900
Alignment:
| Q |
30 |
ttttgcccaaataatgaaacgaggttgaagtttcatgaaaactccatcaaaagagataacca |
91 |
Q |
| |
|
|||||| ||| | |||||||||||||||| || |||||||||||| |||||||||||||||| |
|
|
| T |
42778840 |
ttttgctcaattgatgaaacgaggttgaa-ttgcatgaaaactccgtcaaaagagataacca |
42778900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 3 - 35
Target Start/End: Original strand, 39544473 - 39544505
Alignment:
| Q |
3 |
aatgaaaccagggactgaaacattgaattttgc |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39544473 |
aatgaaaccagggactgaaacattgaattttgc |
39544505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University