View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_1D_low_28 (Length: 271)
Name: NF5039_1D_low_28
Description: NF5039_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_1D_low_28 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 4 - 271
Target Start/End: Original strand, 18270285 - 18270547
Alignment:
| Q |
4 |
aattaaatggtttttgtttttgataagcggattaagtgagcgatgtaagatgttgaaaagctcagctggtgaagacctctttgcaagtgggtgcaaggcc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
18270285 |
aattaaatggtttttgtttttgataagcggatt----gagcgatgtaagatgttgacaagctcagctggtgaagacctctttgcaagtgggtgcaagggc |
18270380 |
T |
 |
| Q |
104 |
atgataaaatctttctttcaaccccgtgaagtaaaaaatgaaccttctccctctctgtgtgatgtggggggtgcatttgttttcctaggtgaatgtgttg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18270381 |
atgataaaatctttctttcaaccccgtgaagtaaaaaatgaaccttctcc-tctctgtgtgatgtggggggtgcatttgttttcctaggtgaatgtgttg |
18270479 |
T |
 |
| Q |
204 |
tatcggcacaagccaattgtttggtacttggataaaatctatagggtttcctgtatcaaaaacagtga |
271 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18270480 |
tatcggcacaagccaattgtttgatacttggataaaatctatagggtttcctgtatcaaaaacagtga |
18270547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University