View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_1D_low_29 (Length: 270)
Name: NF5039_1D_low_29
Description: NF5039_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_1D_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 1e-53; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 5 - 127
Target Start/End: Complemental strand, 671832 - 671710
Alignment:
| Q |
5 |
ttttgcaagaatatggaagatactcacaaaccaatccgcgagtgctgtgatcaaagcctaacatcaccaccaccctcactttcatctgatgattcacttt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
671832 |
ttttgcaagaatatggaagatactcacaaaccaatcagcgagggctgtgatcaaagcctaacatcaccaccaccctcactttcatctgattattcccttt |
671733 |
T |
 |
| Q |
105 |
gcacccagccattacccactctt |
127 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
671732 |
gcacccagccattacccactctt |
671710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 155 - 192
Target Start/End: Original strand, 13478852 - 13478889
Alignment:
| Q |
155 |
tgtagactactcgtgaagctcctccttcaacttcgatg |
192 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
13478852 |
tgtaggctacccgtgaagctcctccttcaacttcgatg |
13478889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 124 - 172
Target Start/End: Complemental strand, 43687154 - 43687106
Alignment:
| Q |
124 |
tcttccgctggacgttgtcgaagaaatcttgtgtagactactcgtgaag |
172 |
Q |
| |
|
||||||| | ||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
43687154 |
tcttccgttcgaccttgtggaagaaatcttgtgtagactactggtgaag |
43687106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University