View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_1D_low_30 (Length: 269)
Name: NF5039_1D_low_30
Description: NF5039_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_1D_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 7 - 201
Target Start/End: Original strand, 42667420 - 42667614
Alignment:
| Q |
7 |
ttatgtctatgcttcttctttcctttcaaagattgttgcattttctcatccttcgttacaattaactttttattctttctctctgcagcagtgttatttt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667420 |
ttatgtctatgcttcttctttcctttcaaagattgttgcattttctcatccttcgttacaattaactttttattctttctctctgcagcagtgttatttt |
42667519 |
T |
|
| Q |
107 |
ttgttttctcaatcctttcagattgatgcgtttctgatccttgcttcttcttgttctttcctttcaaagacgtgtgtacttcaatgtccttgatg |
201 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667520 |
ttgttttctcaatcttttcagattgatgcgtttctgatccttgcttcttcttgttctttcctttcaaagacgtgtgtacttcaatgtccttgatg |
42667614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 229 - 269
Target Start/End: Original strand, 42667642 - 42667682
Alignment:
| Q |
229 |
aagtttaagtccaatccacgataacggttaacatgagtatc |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667642 |
aagtttaagtccaatccacgataacggttaacatgagtatc |
42667682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University