View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_1D_low_32 (Length: 263)
Name: NF5039_1D_low_32
Description: NF5039_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_1D_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 40660208 - 40659955
Alignment:
| Q |
1 |
aaatcataagattatatggaccctactccaagtacatcactgctgcaggatttaaaaggtggtgtgtggctagtggtgcagannnnnnnctgttaagttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40660208 |
aaatcataagattatatggaccctactccaagtacatcactgctgcaggatttaaaaggtggtgtgtggctagtggtgcagatttttttctgttaagttt |
40660109 |
T |
 |
| Q |
101 |
tggttt-tctttgtcatgctttgtgaaggttgaacttggttgttgtcctgtttggagcctatggtttacagggcatgtaggaattgggtatcagcttgat |
199 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40660108 |
tggtttgtttttgtcatgctttgtgaaggttgaacttggttgttgtcctgtttggagcctatggtttacagggcatgtaggaattgggtatcagcttgat |
40660009 |
T |
 |
| Q |
200 |
agtagtgtgcaagccaaatgttccatgatgtgcttc-ttgttgtttgttgatgt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40660008 |
agtagtgtgcaagccaaatgttccatgatgtgcttctttgttgtttgttgatgt |
40659955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University