View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_1D_low_37 (Length: 246)
Name: NF5039_1D_low_37
Description: NF5039_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_1D_low_37 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 15 - 246
Target Start/End: Original strand, 33127411 - 33127642
Alignment:
| Q |
15 |
catcaaagttggtacacgaagcaactaaaacgcattagcacaatccattgaactcgtaatacgagtgcaaaactaaataacaaaaaaggtgtgcgacctc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
33127411 |
catcaaagttggtacacgaagcaactaaaacacattagcacaatccatcgaactcgtaatacgagtgcaaaaccaaataacaaaaaaggtgtgtgacctc |
33127510 |
T |
|
| Q |
115 |
acgatgaactcgaaccaacaacaacccaatgctagcagtagcacaacgaaaacacaaaccagtagtagcgaattgcaataaatagatcaacaacaacaac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33127511 |
acgatgaactcgaaccaacaacaacccaatgctagcagtagcacaacgaaaacacaaaccagtagtagcgaattgcaataaatagatcaacaacaacaac |
33127610 |
T |
|
| Q |
215 |
ctagaagtgaatcttccagatcgtgaagtaca |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33127611 |
ctagaagtgaatcttccagatcgtgaagtaca |
33127642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University