View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_1D_low_42 (Length: 230)
Name: NF5039_1D_low_42
Description: NF5039_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_1D_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 9 - 229
Target Start/End: Complemental strand, 10501399 - 10501179
Alignment:
| Q |
9 |
acacttgctttactcgtgattagaatcaatttgactagaaagtttacgtgcaacaaaatataaaatcgatatcattgattcatgatcatttgtaagatct |
108 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10501399 |
acacttgctttactcgttattagaatcaatttgactagaaagtttacgtgcgacaaaatataaaatcgatatcattgattcatgatcatttgtaagatct |
10501300 |
T |
 |
| Q |
109 |
aatgaagggaaaataaaattttaaattcgatgc---attatgtttattagataatcaacaactttcccttcattttggtgtcaccttccttctgtacaaa |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10501299 |
aatgaagggaaaataaaattttaaattcgatgcaatattctgtttactagataat---caactttcccttcattttggtgtcaccttccttctgtacaaa |
10501203 |
T |
 |
| Q |
206 |
ccattatgagcatcactttgctta |
229 |
Q |
| |
|
||||||||||||||||| |||||| |
|
|
| T |
10501202 |
ccattatgagcatcactctgctta |
10501179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University