View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_1D_low_44 (Length: 226)
Name: NF5039_1D_low_44
Description: NF5039_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_1D_low_44 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 38815461 - 38815254
Alignment:
| Q |
1 |
ccgtgaagggcctctt-gtgtggtgttgtgttagttgtgatttagtttagtggggcctgagaattttatttgcttttgtctaataggaagtggattgttc |
99 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38815461 |
ccgtgaagggcctctttgtgtggtgttgtgttagttttgatttagtttagtggggcctgagaattttatttgcttttgtctaataggaagtggattgttc |
38815362 |
T |
|
| Q |
100 |
tgtggcttcctgtggattgtttggtgagcctagcttggttatgtgttaggagagagcgtctatttcttttgtttgaggagtggttaattaattctctctt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38815361 |
tgtggcttcctgtggattgtttggtgagcctagcttggttatgtgttaggagagagcgtctatttcttttgtttgaggagtggttaattaattctctctt |
38815262 |
T |
|
| Q |
200 |
ttaagttg |
207 |
Q |
| |
|
|||||||| |
|
|
| T |
38815261 |
ttaagttg |
38815254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University