View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_1D_low_47 (Length: 222)
Name: NF5039_1D_low_47
Description: NF5039_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_1D_low_47 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 46531449 - 46531228
Alignment:
| Q |
1 |
gtccaccaaagggagcagcgtcatctagcacagaggtaaagaggtgagtggataaggagttgggatgatcaatggattttgatccaaggaaggagagaag |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46531449 |
gtccaccaaagggagcagcgtcatcaagcacagaggtaaagaggtgagtggataaggagttgagatgatcaatggattttgaaccaaggaaggagagaag |
46531350 |
T |
|
| Q |
101 |
ctgacattgtgtcggaccctcggaaccggcagctactatgctgagcacagtttggagtgacaacggtgaaagcacgacattcttcttcttgaattctgtt |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46531349 |
ctgacattgcgtcggaccctcggaaccggcagctactatgctgagcacagtttggagtgacaacggtgaaagcacgacattcttcttcttgaattctgtt |
46531250 |
T |
|
| Q |
201 |
tttgataccaaatgtttggtga |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
46531249 |
tttgataccaaatgtttggtga |
46531228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 46554807 - 46554929
Alignment:
| Q |
41 |
gaggtgagtggataaggagttgggatgatcaatggattttgatccaaggaaggagagaagctgacattgtgtcggaccctcggaaccggcagctactatg |
140 |
Q |
| |
|
|||||||| ||| |||||||| |||| | ||||||| |||||| ||||||||||||||||||| ||| || |||||||||||||| |||| || || |
|
|
| T |
46554807 |
gaggtgagaggacaaggagttaagatggtggatggattctgatccgaggaaggagagaagctgacgttgagtgggaccctcggaaccagcagtgaccata |
46554906 |
T |
|
| Q |
141 |
ctgagcacagtttggagtgacaa |
163 |
Q |
| |
|
|||||| ||||||||||||||| |
|
|
| T |
46554907 |
ctgagcgtagtttggagtgacaa |
46554929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 54 - 102
Target Start/End: Original strand, 47414953 - 47415001
Alignment:
| Q |
54 |
aaggagttgggatgatcaatggattttgatccaaggaaggagagaagct |
102 |
Q |
| |
|
||||||||| ||||||||||||||||||| || |||||| |||||||| |
|
|
| T |
47414953 |
aaggagttgagatgatcaatggattttgagccgaggaagtcgagaagct |
47415001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University