View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_1D_low_50 (Length: 220)
Name: NF5039_1D_low_50
Description: NF5039_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_1D_low_50 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 179674 - 179455
Alignment:
| Q |
1 |
tggtgtattaggacgttgatatctgacattgcacctagtttagccaaatagtcagcactttgatttccttcccggagggtgtggttgagcgaaaaattct |
100 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
179674 |
tggtgtattagaacgttgacatctgacattgcacctagtttagccaaatagtcagcactttgatttccttcccggagggtgtggttgagcgaaaaattcc |
179575 |
T |
|
| Q |
101 |
ttagagaaagcttgtctctgatgtcttggataagggctacatgaatatggaactttgagctggtggtattgatgagattaattgaaaggagagaatctaa |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
179574 |
ttagagaaagcttgtctctgatatcttggattagggccgcatgaatatggaactttgaactggtggtagtgatgagattaattgaaaggagagaatctga |
179475 |
T |
|
| Q |
201 |
ataaaccgccatgtctgtga |
220 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
179474 |
ataaaccgccatatctgtga |
179455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 206
Target Start/End: Original strand, 45440000 - 45440036
Alignment:
| Q |
170 |
tgatgagattaattgaaaggagagaatctaaataaac |
206 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
45440000 |
tgatgaggttaattgaaaggagggaatctaaataaac |
45440036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University