View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_1D_low_52 (Length: 218)
Name: NF5039_1D_low_52
Description: NF5039_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_1D_low_52 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 7 - 91
Target Start/End: Original strand, 20770365 - 20770449
Alignment:
| Q |
7 |
cacacatactggaaatcattacagccgattccatgcccgttactgctgtgggattgttggttcgtgcaatggattgatctgtttg |
91 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20770365 |
cacacgtactggaaatcattacagccgattccatgcccgttactgttgtgggattgttggttcgtgcaatggattgatctatttg |
20770449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 20770444 - 20770491
Alignment:
| Q |
164 |
tatttgttggttggtctgtcatcgttataattgtcctcagaataatct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20770444 |
tatttgttggttggtctgtcatcgttataattgtcctcagaataatct |
20770491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 59 - 91
Target Start/End: Original strand, 29873906 - 29873938
Alignment:
| Q |
59 |
attgttggttcgtgcaatggattgatctgtttg |
91 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
29873906 |
attgttggttcctgcaatggattgatctgtttg |
29873938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University