View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_1D_low_57 (Length: 213)
Name: NF5039_1D_low_57
Description: NF5039_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_1D_low_57 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 21078440 - 21078589
Alignment:
| Q |
1 |
tgatgcaccaccagttattaacttatccaaatattttcctccaagttcccataaaaagaaaaagcgcagcatcgtgagaagaaatatgattgatcatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21078440 |
tgatgcaccaccagttattaacttatccaaatatttgcctccaagttcccataaaaagaaaaaacgcagcatcgtgagaagaaatatgattgatcatgaa |
21078539 |
T |
|
| Q |
101 |
cttcttaatgcagcacatatactcttggatatgtctcgtggtggtggtgg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21078540 |
cttcttaatgcagcacatatactcttggatatgtctcgtggtggtggtgg |
21078589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 213
Target Start/End: Original strand, 21078612 - 21078652
Alignment:
| Q |
173 |
cacacacctaaaaggctcaaactttcaagcaatactacaga |
213 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21078612 |
cacacacctaaaaggctcaaaatttcaagcaatactacaga |
21078652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 80 - 136
Target Start/End: Complemental strand, 3073780 - 3073724
Alignment:
| Q |
80 |
agaaatatgattgatcatgaacttcttaatgcagcacatatactcttggatatgtct |
136 |
Q |
| |
|
|||||||| ||||||||||||| |||||||| |||| ||| |||||| ||||||||| |
|
|
| T |
3073780 |
agaaatatcattgatcatgaacatcttaatggagcatatacactcttcgatatgtct |
3073724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 80 - 136
Target Start/End: Complemental strand, 27732144 - 27732088
Alignment:
| Q |
80 |
agaaatatgattgatcatgaacttcttaatgcagcacatatactcttggatatgtct |
136 |
Q |
| |
|
|||||||| ||||||||||||| |||||||| |||||| | |||||| |||||||| |
|
|
| T |
27732144 |
agaaatatcattgatcatgaacatcttaatggagcacaaacactcttcaatatgtct |
27732088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University