View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_1D_low_61 (Length: 207)
Name: NF5039_1D_low_61
Description: NF5039_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_1D_low_61 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 40660599 - 40660806
Alignment:
| Q |
1 |
atcaagtagacaaaaagtagcagactggcctcattaacatgtgcttcatgcttaattgcaatcataacaaatgtacatgatgtctattgtataacaaacc |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40660599 |
atcaagtggacaaaaagtagcagactggcctcattaacatgtgcttcatgcttaattgcaatcataacaaatgtacatgatgtctattgtataaaaaacc |
40660698 |
T |
|
| Q |
101 |
ggaggtagtagtaaaaaactagcgcgtaatctataactcctatatctctaagatgttgatcttggttatggctgctgccttttc-attacttcctatttc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
40660699 |
ggaggtagtagtaaaaaactagcgcgtaatctataactcctatatctctaagatgttgatcttggttatggctgctgccttttctattgcttcctatttc |
40660798 |
T |
|
| Q |
200 |
ttctgtga |
207 |
Q |
| |
|
|||||||| |
|
|
| T |
40660799 |
ttctgtga |
40660806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University