View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_2D_low_4 (Length: 263)
Name: NF5039_2D_low_4
Description: NF5039_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_2D_low_4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 263
Target Start/End: Original strand, 36749556 - 36749810
Alignment:
| Q |
18 |
aattctgccatagtgagactgagccaattttgctattaaactggaccaccacagagtatgttaacgggattgctctgccctagaactagaagcacaccta |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36749556 |
aattctgccatagtgagactgagccaagtttgctattaaactggaccaccacagagtatgttaacgggattgctctgccctagaactagaagcacaccta |
36749655 |
T |
 |
| Q |
118 |
agcgaatttgggggatattccatcaacaccgcgagatgacaaccaagtaatcatcatcaacaggtcatcatcactactagaaaaacacgaattagaga-- |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36749656 |
agcgaatttgggggatattccatcaacaccgcgagatgacaaccaagtaatcatcatcaacagg---tcatcactactagaaaaacacgaattagagacg |
36749752 |
T |
 |
| Q |
216 |
----------gggaacaatatctgtcactaattgcgatgaaattagtgacgaaatttc |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36749753 |
taatttagagaggaacaatatctgtcactaattgcgatgaaattagtgacgaaatttc |
36749810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University