View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_2D_low_7 (Length: 225)
Name: NF5039_2D_low_7
Description: NF5039_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_2D_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 10 - 214
Target Start/End: Original strand, 15600224 - 15600428
Alignment:
| Q |
10 |
acatcatcaccctttacaccacctctccacgacccatatgcccctttctcattttctcctttccaccccttatcagaaactatctccccttttctccaat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15600224 |
acatcatcaccctttacaccacctctccaccacccatatgcccctttctcattttctcctttccaccccttatcagaaactatctccccttttctccaat |
15600323 |
T |
 |
| Q |
110 |
tgtcaacccttcccttctccacctgccttcttttccacctctcatcaacaatatccccattctcaacttcattactccgtcgtggtggtgacagtgatgg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15600324 |
tgtcaacccttcccttctccacctgccttcttttccacctctcatcaacaatatccccattctcaacttcattactccgtcgtggtggtgacagtgatgg |
15600423 |
T |
 |
| Q |
210 |
tgatg |
214 |
Q |
| |
|
||||| |
|
|
| T |
15600424 |
tgatg |
15600428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University