View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_high_14 (Length: 473)
Name: NF5039_high_14
Description: NF5039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 195 - 462
Target Start/End: Original strand, 43239075 - 43239342
Alignment:
| Q |
195 |
catgtaaactattgtcttatacatgattcatacatttttctatgctgttttgttagtaattgttaacatcattaatgagtgtttcattcaatttgcagat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43239075 |
catgtaaactattgtcttatacatgattcatacatttttctatgctgttttgttagtaattgttaacatcattaatgggtgtttcattcaatttgcagat |
43239174 |
T |
 |
| Q |
295 |
tcatggcaacaagtggggttgatgttggtgacaggcttcaactgtggttggatattcagtttctctaacctgataatggttccattaggttggacatggg |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43239175 |
tcatggcaacaagtggggttgatgttggtgacaggcttcaactgtggttggatattcagtttctctaacctgataatggttccattaggttggacatggg |
43239274 |
T |
 |
| Q |
395 |
gtatcatattgctctttgttattggactctacacagcttatgctaattggctcttggcagcttttcat |
462 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43239275 |
gtatcatattgctctttgttattggactctacacagcttatgctaattggctcttggcagcttttcat |
43239342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 20 - 164
Target Start/End: Original strand, 43238899 - 43239044
Alignment:
| Q |
20 |
gaaggtagagcaagcaatgataactctctcactctcaacctagaacatggtcaagaagacaagaatatctcaaatgattcttatgatctttccactgctc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43238899 |
gaaggtagagcaagcaatgataactctctcactctcaacctagaacatggtcaagaagacaagaatatctcaaatgattcttatgacctttccactgctc |
43238998 |
T |
 |
| Q |
120 |
atactattgacaaaggtatattactc-tattctcagttaaattatg |
164 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
43238999 |
atactattgacaaaggtatattactcttattctcagctaaattatg |
43239044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University