View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_high_32 (Length: 308)
Name: NF5039_high_32
Description: NF5039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_high_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 18 - 299
Target Start/End: Original strand, 42219599 - 42219880
Alignment:
| Q |
18 |
gtatggaatttggtagttcataagaaaaaggtctttcttttgggacaatgtatgtcatatgaagaaaactgcatgggttaggtggttgaatgtttgtaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42219599 |
gtatggaatttggtagttcataagaaaaaggtctttcttttgggacaatgtatgtcatatgaagaaaactgcatgggttaggtggtcgaatgtttgtaag |
42219698 |
T |
|
| Q |
118 |
ccaaaggatgcaaaggggttaagtgtgaatgatcttcgagtgatgaacctgagtatattagctaaatcgataggggatatatagagctgtaattctcttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42219699 |
ccaaaggatgcaaaggggttaagtgtgaatgatcttcgagtgatgaacctgagtatattagctaaatcgataggggatatatagagctgtaattctcttt |
42219798 |
T |
|
| Q |
218 |
tgtgagtttttggttgggttctttctcgttgattcatgtgtttcttggactgtattatgatttggagtaaaggtaggatttt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42219799 |
tgtgagtttttggttgggttctttctcgttgattcatgtgtttcttggactgtattatgatttggagtaaaggtaggatttt |
42219880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University