View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_high_36 (Length: 300)
Name: NF5039_high_36
Description: NF5039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_high_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 14 - 283
Target Start/End: Original strand, 13672602 - 13672871
Alignment:
| Q |
14 |
catcagtaacagttattcaaaactcttgatataatataacaattattataacttataatgtttggtatttttgctacatagagaacttgattggaaaagg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13672602 |
catcagtaacagttattcaaaactcttgatataatataacaattattataacttataatgtttggtatttttgctacatagagaacttgattggaaaagg |
13672701 |
T |
 |
| Q |
114 |
tggtcatgctgaagtatacaaaggacacttatcagatggtcaagttgtcgcagtaaagagactaatgaagaacgacaaggatttcgcggatagagcaggc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13672702 |
tggtcatgctgaagtatacaaaggacacttatcagatggtcaagttgtcgcagtaaagagactaatgaagaacgacaaggatttcgcggatagagcaggc |
13672801 |
T |
 |
| Q |
214 |
gatttcttaacagagcttggaatcattgcacacgttaatcacccgaacgctacacgccttgtcgggtttg |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13672802 |
gatttcttaacagagcttggaatcattgcacacgttaatcacccgaacgctacacgccttgttgggtttg |
13672871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 92 - 182
Target Start/End: Original strand, 28531275 - 28531365
Alignment:
| Q |
92 |
tagagaacttgattggaaaaggtggtcatgctgaagtatacaaaggacacttatcagatggtcaagttgtcgcagtaaagagactaatgaa |
182 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||| |||||||||| |||| | ||||| ||||| ||||||||||| |||||||| |
|
|
| T |
28531275 |
tagagaacatgattggaaaaggtggtcatgcagaagtgtacaaaggacgcttacctgatggaatggttgtagcagtaaagaggctaatgaa |
28531365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 100 - 137
Target Start/End: Complemental strand, 40114800 - 40114763
Alignment:
| Q |
100 |
ttgattggaaaaggtggtcatgctgaagtatacaaagg |
137 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
40114800 |
ttgattggaaaaggtggttatgctgaagtgtacaaagg |
40114763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University