View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_high_66 (Length: 238)
Name: NF5039_high_66
Description: NF5039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_high_66 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 7e-73; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 18 - 176
Target Start/End: Original strand, 38155262 - 38155420
Alignment:
| Q |
18 |
ttcttcagtactccaaagtgagcaatgattataatcttttgcatacggatttggatgccgctcgaagtgttggatttgaaggtccattttggtgcatgga |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38155262 |
ttcttcagtactccaaagttagcaatgattataatcttttacatacggatttggatgctgctcgaagtgttggatttgaaggtccattttggtacatgga |
38155361 |
T |
|
| Q |
118 |
atgcttgttgcttcgctttttccacatatcatctcatcacattttgtaagtttcgtgct |
176 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38155362 |
atgcttgttgcttcgctttttccgcatatcatctcatcacattttgtaagtttcgtgct |
38155420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 18 - 191
Target Start/End: Original strand, 38148796 - 38148967
Alignment:
| Q |
18 |
ttcttcagtactccaaagtgagcaatgattataatcttttgcatacggatttggatgccgctcgaagtgttggatttgaaggtccattttggtgcatgga |
117 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||| | |||| || || |||||||||||||||||||| |||||||| ||| |||||| |
|
|
| T |
38148796 |
ttcttcagtactccaaagtgagccatgattataatcctttgcatgccgattcggcggctgctcgaagtgttggatttgacggtccatt--ggtacatgga |
38148893 |
T |
|
| Q |
118 |
atgcttgttgcttcgctttttccacatatcatctcatcacattttgtaagtttcgtgctaaccctctctttaaa |
191 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||| | |||||| ||||||||||| |
|
|
| T |
38148894 |
atgcttgttgcttcgctttttccgcatatcatctcgtcacattttgtaagtcccatgctaatgctctctttaaa |
38148967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 204 - 233
Target Start/End: Original strand, 38155417 - 38155446
Alignment:
| Q |
204 |
tgcttgaaatgatatagcaatgtttggata |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38155417 |
tgcttgaaatgatatagcaatgtttggata |
38155446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University