View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_high_68 (Length: 237)
Name: NF5039_high_68
Description: NF5039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_high_68 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 2 - 228
Target Start/End: Original strand, 42237567 - 42237793
Alignment:
| Q |
2 |
gggcacttgtactataagctccaaacaaagttgtttatccaaaccaggcataatcttgaatcaaacataatattgttaaaaagaggaagggaattgaatt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42237567 |
gggcacttgtactataagctccaaacaaagttgtttatccaaaccaggcataatcttgaatcaaacataatattgttaaaaagaggaagggaattgaatt |
42237666 |
T |
 |
| Q |
102 |
ataccttcccattgcatcataagttgctgcaagattgctatatacaccgagagtatcttgatgacaaggtccacattcttgttcaagaattcccctagct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42237667 |
ataccttcccattgcatcataagttgctgcaagattgctatatacaccgagagtatcttgatgacaaggtccacattcttgttcaagaattcccctagct |
42237766 |
T |
 |
| Q |
202 |
tcctcaaacaattcagcagcttcatct |
228 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
42237767 |
tcctcaaacaattcagcagcttcatct |
42237793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University