View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_high_76 (Length: 217)
Name: NF5039_high_76
Description: NF5039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_high_76 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 2 - 217
Target Start/End: Complemental strand, 699747 - 699532
Alignment:
| Q |
2 |
ttgaaatctcttcatctgatataccaacactcctcaaaatctcccactgataagcctgtccgcttgattttgcagcagccttagacttcttccctttgta |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
699747 |
ttgaaatctcttcatctgatataccaacactcctcaaaatctcccactgataagcctgtccgcttgattttgcagcagccttagacttcttccctttgta |
699648 |
T |
 |
| Q |
102 |
cttgttattaagcgaaggttttgcattggaatcatcgtcggcagcaccctcggtgcccatggcattgtcttcttgtacccccgggaacacgggtaggttt |
201 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
699647 |
cttgttattaaccgaaggtttggcattggaatcatcgtcggaagcaccctcggcacccatggcattgtcttcttgtacccccgggaacacgggtgggttt |
699548 |
T |
 |
| Q |
202 |
ccgaattgttgaattt |
217 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
699547 |
ccgaattgttgaattt |
699532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 67 - 158
Target Start/End: Complemental strand, 697590 - 697499
Alignment:
| Q |
67 |
gattttgcagcagccttagacttcttccctttgtacttgttattaagcgaaggttttgcattggaatcatcgtcggcagcaccctcggtgcc |
158 |
Q |
| |
|
|||||||| ||||||||| |||| ||||||| || || ||||||||| || | ||||| |||||||||||| || |||||||||| ||||| |
|
|
| T |
697590 |
gattttgcggcagccttacactttttcccttcttatttattattaagctaatggtttgcgttggaatcatcgacgacagcaccctcagtgcc |
697499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 4 - 98
Target Start/End: Original strand, 23262378 - 23262472
Alignment:
| Q |
4 |
gaaatctcttcatctgatataccaacactcctcaaaatctcccactgataagcctgtccgcttgattttgcagcagccttagacttcttcccttt |
98 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||| ||||||||| |||||| |||| || | ||||| |||||| | || || ||||||||||| |
|
|
| T |
23262378 |
gaaatctcagcatcagatataccaacactcctcataatctcccattgataaacctgcccacccgatttcgcagcaacttttgatttcttcccttt |
23262472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University