View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_low_27 (Length: 350)
Name: NF5039_low_27
Description: NF5039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 19 - 264
Target Start/End: Complemental strand, 32273255 - 32273016
Alignment:
| Q |
19 |
gaggagagtgtctataagggcaagaccaactttgaattgtgtgcccatccatatggtaatattaattgttagggttgataatactattaattgttttatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32273255 |
gaggagagtgtctataagggcaagaccaactttgaattgtgtgcccatccatat--------taattgttagggttgataatactattaattgttttatg |
32273164 |
T |
 |
| Q |
119 |
acnnnnnnnnnn--gttnnnnnnntgttttacgacattgcatcaaatttagcattgtttttcattattatagtaaatagatccgcatgttgcttcgagac |
216 |
Q |
| |
|
|| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32273163 |
acttttttttttttgttaaaaaaatgttttacgacattgcatcaaatttagcattgtttttcattattatagtaaatagatccgcatgttgcttcgagac |
32273064 |
T |
 |
| Q |
217 |
tcattcctatttccttgttccctcagaaacagaaacaagtacaacgag |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32273063 |
tcattcctatttccttgttccctcagaaacagaaacaagtacaacgag |
32273016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University