View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_low_37 (Length: 304)
Name: NF5039_low_37
Description: NF5039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 2e-46; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 156 - 254
Target Start/End: Original strand, 14222661 - 14222759
Alignment:
| Q |
156 |
gaacctagtgacagagataaaggaagggaacaaggtctgatgagaagtaacggatcttttggtttcacctttgctagaaactccctcacactcttacaa |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14222661 |
gaacctagtgacagagataaaggaagggaacaaggtctgatgagaagtaacggatcttttggtttcacctttgctaggaactccctcacactcttacaa |
14222759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 162 - 237
Target Start/End: Original strand, 14232509 - 14232584
Alignment:
| Q |
162 |
agtgacagagataaaggaagggaacaaggtctgatgagaagtaacggatcttttggtttcacctttgctagaaact |
237 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
14232509 |
agtgacagagataaagcaaggaaacaaggtctgatgacaagtaacggatcttttggtttcacctctgctaggaact |
14232584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 74 - 121
Target Start/End: Original strand, 14222397 - 14222444
Alignment:
| Q |
74 |
aatacaacaataaaagagattcctaagaaaattactgcagaatcaatt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14222397 |
aatacaacaataaaagagattcctaagaaaattactgcagaatcaatt |
14222444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University